EST 1592683 is a singleton


Sequence

>1592683 (1 EST) Length=335 TCATTCGCTTCTTTTGTCCCCCGCACCATCGGCGACGTTCCCCTACGAGTGTGTCAGGAGTACCCCGGGTTTCAGGTTTT TGTCAAGAGTGACGGCGGCCGTCCAGTTGTCCACAAGCTTTGCGATGTACACAACCGCCCACTCCTTGTTTTTGTTCACG CGTGCCTTCAGCGTGTTGCCCTTGAACAGCACGCAGGCCGTCTCAAAGCCCAGGGTCCCCGTCCAGCCCTGCCCACGGCC ACACACCACCTCGGCGCCAACCAGCACGTGATGGGGGCACTTCGGTATCGGCGTCGCAAAGCTGGTCGTGTACGAGCGCA NTTGTTCGTGCGGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1592683: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15926832961953AA866508TENU0080T.cruzi epimastigote normalized cDNA Library


Date: 4:34:29 on Sat 25 Nov 117.