EST 1592684 is a singleton


Sequence

>1592684 (1 EST) Length=217 TAAATATATATATATATATAACAACCTAGAATNGACCANTGATTGGAACAGCCGACAATAATCAGAATANTTTGTTTCAC TTCCATGGAGGGGTTAGAGAACGCAACNACACGGCCAGTNCCCAAATAATGCAAAGACGGCAATATGTGTTAAGAGGAAT CACGTTTCCGTGGCGAATGTCCTTCAATCACATGTACGCCACCTCCCAAACCCACCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1592684: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15926842961954AA866509TENU0081T.cruzi epimastigote normalized cDNA Library


Date: 5:7:19 on Sat 18 Nov 117.