EST 1592686 is a singleton


Sequence

>1592686 (1 EST) Length=427 GCGAATGCGAACAAATTCTGTTCCTATATCCTCTTTCCGCGACAGTCCTCGTGGTTCGGGGAACTTCTCAAGTTCGCATC GGCACAGTTTTTTTGTCTATACTGAGGCAGACGAGAGGAAAGAGGAGGGAACTGAGTGGAGGACATTTGTGTCGAACGTG TTCCCACCGCGTGATTCGTCGGAATCCGCCAGCGTGCAAGGAGATCTCAAGTTTTCAGGAGAACGCCTTCCAGAGGCAGA GAAACGGGGCGACATGCAACACCGGAAAGAGTTCTATTTCGTCTCAACGAGTCCGAAGCCATTCGAGTTTTGGACCATGC GGAGATCTTGACGGGGAGGAGCGAAATGCCGACGCCGGATGTGTCTGTGCCCAACGCATGGGGTTCAGGACTGGTCCCTC TTCGGACGCATGAAGTTATTCTACCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1592686: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15926862961956AA866511TENU0083T.cruzi epimastigote normalized cDNA Library


Date: 7:34:52 on Sat 18 Nov 117.