EST 1592692 is a singleton


Sequence

>1592692 (1 EST) Length=276 TAANGTTTGGATTANTTGGACTTTTGGCACTGTACCCCCATCACATCTAATTTTCTTTTTTNACTTTTCTTGGCATGATA TACAATAGTACTATTTCTGGGTTGTAGCCATCAATAGAAATGGCCCCACGAAGTTCCGCGCCCCAAATACAAACTTTTTT TCTTTCCTTTANGGATTTCCCGGCAAAAATAATAAGGCGTCACCGCAAGTGGAGGTGAAAGAGCCACTGGGCCTCGTCAT CCGCGCCCACGTTTGAACAGCGTAATTCCTCGTCGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1592692: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15926922961962AA866517TENU0089T.cruzi epimastigote normalized cDNA Library


Date: 22:31:45 on Thu 23 Nov 117.