EST 1592694 is a singleton


Sequence

>1592694 (1 EST) Length=234 TGTTTTGTTTTGTTTTCGTGTCTGTACATTCTGAAGGATCTTGGACCCCAAACAAGAAGAGAGGCGCACACAAACGGAAT AAAAGTAACCCAAAAGAAGAGAAGAAACGCCCTTTCGTTCCTTCTCTCCCGCCTCGCACATCATCGTCCACCGCGAAGAG AACAGACGTGAGGAAAGGTGGAACAGTTGAATGGGGGGTAAACAACAACAATCAAAAAAAAAGCAGAAAAGCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1592694: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15926942961964AA866519TENU0091T.cruzi epimastigote normalized cDNA Library


Date: 16:22:49 on Fri 17 Nov 117.