EST 1592698 is a singleton


Sequence

>1592698 (1 EST) Length=218 TAACCCAACAGCCATCACCCGACTGCTCGTCATTGTCTCCCTCCACAGGAAAAAAACAAAAAATAATTTAAAAAAAAAAC GAAAGAATAAGAAAAAAAATTAAATTAAATTTAANAATATAANACNTANAGATAAAANATAAAAACTTTTGCGTTAAAAT TTAATCCCAAACACCGCCTAAACCCTTCACCCTCTCTCCCTCCAACCAATACTTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1592698: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15926982961968AA866523TENU0095T.cruzi epimastigote normalized cDNA Library


Date: 16:12:11 on Sat 18 Nov 117.