EST 1592699 is a singleton


Sequence

>1592699 (1 EST) Length=514 TAAAAACAGAAAATATCACATGCACACGTACACAAACACAAACACAATCACAAAGACTCATGACGCGCCTGTCGTAAAAA TTCACTCAGCCCCTTCATGATTTTTCCGCACAGCCACCCTGCAAGAAAGGAATTTACTCAGGGGCCCACCACCAACACCA CCAACACGCCTCTTCGCCCCGCCCCTTTCTTCTTGACATTTATTCTCCAAGTGTCACCGCCTCCATTGATTTGCTTCCTT TTTTTTTTTTCCTTTTTTTTTTTCTTCTCCCCCCTCCCTCTCCGTGTCGTTCTTCCCCTTCAGCCTGTGTTCACTGCACG GTGTCCGCAGGTAAATACATACACGTACATACATGCGTAACGCACACTAATTCATCACCGGCGTCAACCACCCCCTCAGT AAATTAAATACGGTTTTCTTTCGCCCCTCTGCGGCAATGTCGGTGTGACGCTGCGAAGACGCGCTAAACCCACTGCCAGG AAGACCCACCGGCTCAATTTGCAATGAGACGAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1592699: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15926992961969AA866524TENU0096T.cruzi epimastigote normalized cDNA Library


Date: 8:26:7 on Wed 22 Nov 117.