EST 1592700 is a singleton


Sequence

>1592700 (1 EST) Length=358 TATACACAAGAATGCAATAAAGGTGCAAAAAAAAAAAAAATCGTGGAGCACAAACCGCATCTCATAAAAAAAAAAATGGT GAAAGTCTTANAGGCATGTGTTTGTTTCTTCTTTCCTTTTATTTGCCAGCTGGGAGTGAGTTCCTGTGCCTTTAGAACGT TTAAAGGCATTACTCCTTCTGGGAANAACGCGGACGCTTGNGCTCTGCGCGGAGTCGTCCCCGTCTCCTGCTGGGACGGA TGCGCCGTTCGAAAACACCTCCGTCATTATGCGTTGCAGCATCGCATCCTGCTCGGATTCCTTCTGGACCTCTGCGGCAC CCNTACAGCCTCCATCTGGCGATANACCGCTTCCTCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1592700: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15927002961970AA866525TENU0097T.cruzi epimastigote normalized cDNA Library


Date: 14:42:16 on Fri 17 Nov 117.