EST 1592702 is a singleton


Sequence

>1592702 (1 EST) Length=507 TAAGGTCGTAGAAAAAAAAAAATCTTTTTTTTTTTGGTTTGAAAAAGAAAGAAGAAAAAAAGAGCAGAGACGCGGAAAAA AAGAGGATCGTCTGCAGGGCCCCANTCCCCGCACGCTGCAAAAGGCGGCGTTAAATGGTCTCAGCAAACGATGGGTGTGC TGCAATGAGAACAAACTCTTCCCGCGCCTTCACGTCAGTGAGACACTGCAGATGGTACAAGCTTCTCGCAGACTTGAGCT TCTTCCGCATCGCCGCACTCGATGTGTACTTCTGCAGCAGTTGCCGCAGTACACCTGCACCTCCTCCTCCAATAGTGAGC AGTAAAACGTCTCTCCCCCCTCGCCATCCGTGCCTCTCACAAATGAGCGCGAAACGAGCAAATGAACAGCGAGANATCCA CAAGGCATTCGTTGAGAAAACTCAGTTCGTCCCGCGGCGCTGGTGCCTCACCGCATTGCGCCGCCATCACGATGGCAAAG TCCCCTCGTGCCGAATTCTTGGCCTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1592702: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15927022961972AA866527TENU0099T.cruzi epimastigote normalized cDNA Library


Date: 13:34:35 on Thu 23 Nov 117.