EST 1592703 is a singleton


Sequence

>1592703 (1 EST) Length=415 TATTTTATTTTATATTACATACAAAAACNAAAAAAAGGTGGTGTGGAGGATTAAATTCACCGAGTCCACAGAATTGCTGC GTGCACCACCTCCACGCTGAATAAGGAAAAAATCTTATAAATTGAAAAAAGTATAAACATATTCATATATGCACATGCAT ACGAAAATACATATGGGGAAAGGAAAGGAAAGGGAAGAAGAAACAAAAAAAAAAAAAAAGTATTTCTAGCGCAAACTGCC ACCTGCTCCTCCCTCCGCAAGGACAACTCGNGGAATAGAGTATAAAACCCTCCTTTTTTCCCCTTTCTCCCCACACACAA ACACTGATATTACTGGTTAAGAGTTGTACACAACGATGGCGCCAAGGGATACGGCATTTCCAACCAAAAATGTTGCGCTC GGACAAAACGCGTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1592703: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15927032961973AA866528TENU0100T.cruzi epimastigote normalized cDNA Library


Date: 5:5:21 on Sat 18 Nov 117.