EST 1592707 is a singleton


Sequence

>1592707 (1 EST) Length=451 TATATTAATTATTATTCGAGATCCTCCTCGGAGTTAAATCTTCTTCTTATTTGTGCCTTCTTTTTTTTTTTTTTTTTTTA CGCACGTGCACAAACAGAAAGAAAAGAGGGGCAACGGGAGAAAATGAACAACACTGAGAAGATTAATTTCACAGATGAAA AGTAAAAAAAAAAAAAACTCTCTTTTTCTCTTTCTTTTTCTGATTTTTTTTTTTTTTCTTTTCTTCTTCCTTTTTGAAAA GTAGACATGTCCTTTGACTCCTCACTCGCCCTTATTTGTTTCATGGACTGCTCTTGTTAGTTGCTCCATCACAGCCGGCC AAAGGGCCAACGGAAGCGTCGCTCAATTTTAAAGTATCCCGATGGTGTCAATCCTGGGTTTTTGAGCTGTCTATAAAGCT TCTCCTTCTCAGGTGTGGAGAGGGGAAGAGTAGTCGGTACAGGTGTGGGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1592707: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15927072961977AA866532TENU0104T.cruzi epimastigote normalized cDNA Library


Date: 10:42:55 on Tue 21 Nov 117.