EST 1592711 is a singleton


Sequence

>1592711 (1 EST) Length=501 TAAACAGAATTACATGGGTAGTGGCACAAAGGTGGAATAATCGTGCGAATGTGTTCCACGTTTACATGCGGTACCTCGCC AACAAAATGGCGTAAAATGTTCGCCAGTACATTGAGTAAAGTTAAACATTGCGACAAACTATGATGCCAATAAAAAGTTT ATTCTCCCCTCAACCCCTCAAATAAACCCTCTCGCACACACACACACAAGTACACAGCTCCAATAACAGCGGTAATAGAC CACACTGCCAAAAGGGATGCCTACTGAAAAAGAGAGAAAGAGAGGGAGAGAATGAAAGGGGAGCAGGTGACAAGGCACCA AATAAATACATTTCAATGAAACCTATGATACGCCCTACTCTCAAATTATCGGTTTCTTGTTGTGGACCAAGTTTCCTGCT TTTTNCCCTTTTCTCGCAGATATTTCAGTCTCTCTTGCTCCTCAANGGAGGTAATACAGGCGGATGATGTTCACCTTCGA TCCCACAGGCTGCCTCGTGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1592711: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15927112961981AA866536TENU0108T.cruzi epimastigote normalized cDNA Library


Date: 12:2:15 on Fri 24 Nov 117.