EST 1592713 is a singleton


Sequence

>1592713 (1 EST) Length=457 TACGCCGGCGGGGTTATTTCTGGTCACGCCGTGCATCATTTTCTTGGTTTTGTTTAATGAAAGGAGCAAAAAAAAAAAAA AAAAAGGAAATGACGCATGTCGTCCAGCGTAGGAAACACAGAAAACGAAAACAAAAACAAAGTCCGTGGCATTTCAGTGT TTTGATTCCATTAATTTTCCTTCGAGTGCGCCGTGTACCCAAAATGCCACGCACACATTCATTCATCAACGTCGCACTGC CGCCAATTCCATGACGGCAGAGGAACAGGCCGCCAAGAAAGCGCACGTCGCCCGCCGACGACAGCCCGATGGGAACACCA CCGGTCGAATTTCGGTTTTCAGGACGCGGGGTTTCAGTGCCACAGAAATGACGGACTGACCCACCGCCCCACGGCATGCC ACGTCACGGGCATCGACCGGCCGAAGTGGATTGTGCAATGACACAAGTCCACATCTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1592713: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15927132961983AA866538TENU0110T.cruzi epimastigote normalized cDNA Library


Date: 2:41:16 on Thu 23 Nov 117.