EST 1592715 is a singleton


Sequence

>1592715 (1 EST) Length=383 TGTATTGATTTTTTTTTGTTTGTGTGTGGGGGAGGAGGGTTGTTCCTCTGTGTTGTTTATTTGTTTATTTAATATGTTGC CTGGATGGTTGATGTTTTTGGTTCTTTTTGTCTGCTGCGGTGTTTTCTACTTTGTTATTGTGGACATTTGATATTATTTA GAGGCTTTTTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTCACCGTCATCGCTGCTGTATTCCGTGTCAAAATGCCTGTT ATTGCGGTTCCATCATTTGTTTTTCTTCATTTTCGTAAAATGACTAATGTGAAGCATTTCTATTGTTGCTTCCTTTTGTT TTTGTTTGTTTGTTTGTTTGTTTANATATATGTGTGGGTGGGTGCGGCTTTGAATGGTGGGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1592715: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15927152961985AA866540TENU0112T.cruzi epimastigote normalized cDNA Library


Date: 4:23:2 on Fri 24 Nov 117.