EST 1592719 is a singleton


Sequence

>1592719 (1 EST) Length=403 TCATGCATCGTGTCCGACTTTTCGCACCGAAATTGGTGGCGACGGGCGGTCGCGTATTTCTTTTAACCAAAAGGGCGGCA TTCAATAGGAAACCCCACGCAAACGTAAAAATAGAATAACACCGTGCACAACAACAATGTTGCGCGCTTCGTGAGCTGCA TGCTGTCGGTGTGGTTCGGCGTTCCCGAGGAGGCCGTGAGTGGGCGAGTCGCCTTGGTATCACTGTCTCTTTGGTTTCTG CGACAAAATTTTATAATGCATGCGGCTTGTCACTTATTTAGTAATTGTATCAGCGGACACGGGAGAAGGGTTCATGCCAT TGTGTGGGCAAACTGGGAGAGGAAAAAAAAGCATCTCCACGTGGTGCGCTCGGGTCCCCACGGAAACTTTTCTATTGCGT GAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1592719: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15927192961989AA866544TENU0117T.cruzi epimastigote normalized cDNA Library


Date: 4:13:5 on Wed 22 Nov 117.