EST 1594122 is a singleton


Sequence

>1594122 (1 EST) Length=290 CGGANCCGCTCTGGGANAAAAACACAAATCATGGCTGACGAAAACACNGGTTTGAAGAAACATGATGAAGGAAACCNCCC GTCACTCAACAATTTTGAACGTTGGAAACCCGAAAACCTTAAAAGAATGCCCATCCGCCATTGGTCGTTCGCAAGTTCAC TGGGAAATNAACGGGTCTGGTTGCCGAAGGCCTCTCCTGAAGGTTGCTCCNCGCCCCTGGGAACCGCCCGTACCCGCTCC ACATTGTNTTCTTCCTNCGCCCGCGGGACTGGCGAAAAACAAAGGAGTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1594122: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15941222963378AA867933TENS0040T. cruzi epimastigote normalized cDNA Library


Date: 23:41:38 on Fri 17 Nov 117.