EST 1594140 is a singleton


Sequence

>1594140 (1 EST) Length=294 GATNTNCACCCATCCAAAATCNANTNACAATTGGAGGACAANTCTGGTGCCACCACCCGCGGTAATTCCAGCTCCAAAAG CGTATATTAATGCTGTTGCTGTTAAAGGGTTCGTANTTGAATTGAGGGCCTCTAAGGCGCAATGGTTTANTCCCATCCAC TTCGGATTGGTGACCCATGCCCTTGTGGTCCGTGAACAGACATTCAGAAACAAAAAACACGGGAGTGGTACCTTTTCTCT GATTATCGCATGTCATGCATGCCANAGGGCGCCCGTGATTTTTTACTGTGACTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1594140: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15941402963396AA867951TENS0059T. cruzi epimastigote normalized cDNA Library


Date: 6:53:43 on Sat 25 Nov 117.