EST 1594169 is a singleton


Sequence

>1594169 (1 EST) Length=250 AAATCGGCACGAGGCTTTGGTATTGGCCACNATGTTCCGTACGCCCGTGATCTTTCTCGCTTTATGCGGTGGCCCACGTT TGTGACNATGCAGCGGAANAAGCGTGTACTGCAGCGCCGTCTGAGGTGTAGTATAGGTGGAAGCGCAAGCACAAATGAAA TACCACCACTTGGAACGTTGCTTCACTTATCGAATGAANANACCAATGGGTTTCGCGTANTCTGCGGGCTATGCACCGTC TAGGTTTGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1594169: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15941692963425AA867980TENS0044T. cruzi epimastigote normalized cDNA Library


Date: 12:53:50 on Sun 19 Nov 117.