EST 1601112 is a singleton


Sequence

>1601112 (1 EST) Length=241 TCGTCAATACTCATTCCCGCTCCCCANAACGCTTTATTCAGCACCGCCCTCTTTCATCCCANACCCTTCACCATCGTTTT CCTTTTCTTTTCTTACGACCAATGGGGAAAATAATACCCAAATTCTTGTTATTTTGGCGTGTGCTAAAGCCGTTTGCAGT ACCTCCGTTCGCCAAATGGGNGCAGTGAGTCGATCGCAATGACAAGAAAAATTAAAGGNACAGTGTAAATAAACAAGACA A


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1601112: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16011122979717AA874769TENU0129T.cruzi epimastigote normalized cDNA Library


Date: 20:30:14 on Tue 21 Nov 117.