EST 1601121 is a singleton


Sequence

>1601121 (1 EST) Length=300 TTATGTTCTTTTGCTTTTGGTTCATTTGTTTTCAAGCAGCCCTTCAGTCGCCTCACCTTCAGGGAAAAAGAATATGCATT TGTAATGCATGCAGATATATAGAATGAAACAAAAAGGAAAAAAAAAAAAACGTCCGAATTTTTTTTTTAAAGAAATTCCT AAAAATGTCTTACACCTCTCCCACATATTCAATGGCCCTTTAACCACTGAAGAATACGCGCTGAGCGAAATCAAATATGT GTTCTGTTGTCGAGAATTCCTTGTCCGAAGCCAACTATGGCCTTCCTGAAGTGCGAGCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1601121: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16011212979726AA874778TENU0138T.cruzi epimastigote normalized cDNA Library


Date: 6:55:14 on Sat 25 Nov 117.