EST 1602017 is a singleton


Sequence

>1602017 (1 EST) Length=320 TGATGCGTAGAAACACATGTTTAAAACAGAGAGAAACAACAAGAGCAGAAGTGGTGGCAATAACGCACACACGCACATGC ACATACTATATATGTCTATAAGGACAGGGATTCCATGCCTGTGTACGTAAGATACAAAAAAGAGGTGCAGAGAATAAGAG GGGCAAGTGGTTACTGATAGGCTCGCTCTCACACACAGAGAGAGAGAGAGACGCTCTCTCCTCCTCTATCTTTCTCCTTC CATCAGAGGCCCCGTAAAGCGGTCGGAGGGCTGCAGTATCACCTCCAGCTGCTTTGCCATCCGCACCACCTGCGCCCGCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1602017: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16020172981504AA875674TENU0146T.cruzi epimastigote normalized cDNA Library


Date: 18:28:21 on Sat 18 Nov 117.