EST 1602028 is a singleton


Sequence

>1602028 (1 EST) Length=407 TATATAAAAACAACCCAATGTTTTTCACCAGAAAACAAACAACCCCACTCCCTCCCTAATTTATTCTGCCACTGTTATGT TCGATAGCGTTGGACAGTTCTGAAATCCGTGCGATATACTGTCGCCTGGTGCTGGTGCATCCGCACCGTATGCACACAAA AAAGTATCCAAAAATATATAAATCCCACAATATTTTTTTACCAGAAATCAAAACTACCCCTTTCATTCCCTAATCCGTTT TCCTATTTCGTTTTTCCTCACCTCAGAGAGCTTCGTCCCTTATGGCATCGTCCGACGATATTGCTGCCATGTACTGGCGC ACTTCTTCCTCCCAGAACACCGCAATCTCTCGGTTTTCAGCGCGGCTCACATTATTGGAGTCGACGACATCGCATCTCTG CCAGCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1602028: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16020282981515AA875685TENU0157T.cruzi epimastigote normalized cDNA Library


Date: 5:49:58 on Sun 19 Nov 117.