EST 1602037 is a singleton


Sequence

>1602037 (1 EST) Length=256 TCAGACGCAGACGCATCAGTGCCTCTCGNGGATTTCAATTCACATACCGCGCAGTTATGCATTCACGTGCTTTCGCAGGT TGAACCCCCAAAACAGGTCAAATAAATAAAAGAACAAAAAAAGAAAAGAAAAAAAAAACGCTCTTCTAAATAAGAATGGT CCAAACGNTGCCTTTTTTCCCCTTCTCCCTCCTTCCCTATCTCCGTCACTATGTACAGCTCTGTTTTTGGNTTTCACTTT CACACTTTTTCTTTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1602037: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16020372981524AA875694TENU0166T.cruzi epimastigote normalized cDNA Library


Date: 9:30:46 on Sun 19 Nov 117.