EST 1602050 is a singleton


Sequence

>1602050 (1 EST) Length=481 TCAGAAAATTGCAGCTGGTATTGTCCGCNCTNCCCNCTTTTAATGCGGGCAGGGCTGGAAGAATTAAAAAAAAAAAAAAA AATGGGGACGGCACGCTGAAAAAAGCCCACAAACAACAAGTTGAAGACAATGAAAGTACCATCACTACGTCGCCCAGTAT CCGGTCTTCTTTGTTGCCCGCCCACGATTCTTCATGGTGTGCGCAGAGAAGCTTTTACCGCCAAATCCCGTGCGCTTAAG CCCCTTCATCAGCGTGCCGCCTCCACCCATGAAAGAATAGCCGTGCGCAAAACCCACAACCGCAACACGCGACGGCTGCC CTGCGCCCGCCAGCCAAGGACACATATAACCCTCCGCTTGCATATAGAGTGAACGCTGCTTGCGGACTCGCGAGACGTAC TTTTCTAGGATGCGATCCAACTGCTTCCGTCGAGCACTTTTCCTCAAGGACCGCTGGAGCGATAATGTTTCGCCTTCCGA G


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1602050: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16020502981537AA875707TENU0178T.cruzi epimastigote normalized cDNA Library


Date: 4:42:26 on Sat 25 Nov 117.