EST 1602055 is a singleton


Sequence

>1602055 (1 EST) Length=479 TGTTGCTTCGTTGACTAAAAATGTTTCTCCTTCTTTCGTCTCGATTTTCTGTTTCAAAGATCACGAGTAAAAAATCTGCA AGGCGGCCGTAAAGGGGCTAACAAAGAAAACGATATGCTTGAAATGTATACACATTGATGCGTCCCTCACCTTCTTTCAT GTTGTCACTTTTGCTACCACCACCACAACTATTATTATTATTTATTATTATTATTATTATNATNGCTGCTGCATCCGCCG CCACAAATATGTTTGTTTTCATTCCTGTTTTACTGTTTCTTACCATCATCTCTCTCATATTTCACCCATTTCAGCTCACT CGATCCATACATGTGACGCCCTTTCCAGAACAATGTATCGATGCTCACCACTGATTGTGAAAGTTATTCGTCTGCATATA TCCCACCTGCGAACGCTGGTTGAACATCGGGTTCACGCCACCGTCAGCATGGGTCCACGCAACTCTCCGGCTCCCATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1602055: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16020552981542AA875712TENU0183T.cruzi epimastigote normalized cDNA Library


Date: 16:19:27 on Sat 18 Nov 117.