EST 1602057 is a singleton


Sequence

>1602057 (1 EST) Length=222 TAATAACCCTCACACGCAGAGAATTAACACCCGCACGCACCGCGGCGCCAGCGGTGACACCCAACTGCGTGGGAAACGAC AGTACTAGACATGCTGGGAGCTGCTTTCGCCGTAAAGCGCACGCACAGAGCACGCAAAGAACAACAACGGAATACATTTT TTTTNTTTTTTAAGGCGTCAAAATTAAGTTCTTAAAAAAAANAAAAGAAANAAACGCACACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1602057: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16020572981544AA875714TENU0185T.cruzi epimastigote normalized cDNA Library


Date: 7:22:38 on Sun 19 Nov 117.