EST 1602059 is a singleton


Sequence

>1602059 (1 EST) Length=404 TAAAAAAACATCCATTGACGCTTAGTTATCTCAAAGTAGAACTCTCGCGGGGTCTGCAGGTGCGGCAGATAAAAAGTACA TCGCATCCATTGCAGCTACCACAGATTTTTTCGTCTTCCCAAAGGAATAACAGAGAGAAAAATCACCAGAAAAGGCGCCC ACCTTGTCGCTGGCCAAAGCATTCGCATGCTCGTCGGGACACTTCTACACGCCTCACCGCCGCCTGTGCGANCACAACGC ATATGAGTTGGCGAATCTCAGCCCTTGTAACTCAAGAGGATATGCGGGGCACCATCTTCGGCAGGGAAACATTCAGGCAA ACGCATCCTTCCCCTCTTTGGGTGCGGCGTGTAAAATATCGCAAGAGGCTGCACATTTTCGCTACACTGTCATGGTATTA CAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1602059: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16020592981546AA875716TENU0187T.cruzi epimastigote normalized cDNA Library


Date: 5:3:33 on Sat 18 Nov 117.