EST 1602064 is a singleton


Sequence

>1602064 (1 EST) Length=380 TCGTGCGCAGTCATCATAAACACAAACCTCAAACACTGCCTAAGCGTATGTTTGATAAACAAAACCCAAAAATAAATAAA TAAAAACGGAATAATCTTCTGTGCCGCTGGCCAAATTCTGAGTTTCTCAATCATAGAAAAAAAAAAAAAAAAAAAAAATT GAAACAAGAAAGGAATGAATGGAATAAGAATGGATCCATTATACCCTCAAAGTTTAACAATAAGTAATTGTACATGCATA CATACATGTATCATCCGTTAGCCTCAATTGTGGCCCGCTCACCCCATTCGGATTGGATATATATATAATTATTTAATAAT TATTACTTACTTACGAATTGACAGACTTTGGGGCTTTCCAACCACAAGACCCCGCCGCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1602064: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16020642981551AA875721TENU0192T.cruzi epimastigote normalized cDNA Library


Date: 5:45:23 on Sun 19 Nov 117.