EST 1602068 is a singleton


Sequence

>1602068 (1 EST) Length=266 TCAAGCAAATGGTCCGCACCGCGATAATACGTGCCGTCAGACCTCATGGCGTCACGACTGTGCACCAGCAGACGCGGCTG GTCCGGGCACTGGTCGATGCCCTTGGTCTTGTGCACACGATAACAATCCCGTGAGAGAAACATGACTTTCTTTTGGCTTT CCCTCCCTCCGACAATTCAGGGTGCAATTTGTCCTGGCGCCACGATGAGGTGGCCGGCGTTGCCAGGGGGTCCAAAAAGC ATAAGTGACGTCAAAAATGGCAGACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1602068: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16020682981555AA875725TENU0196T.cruzi epimastigote normalized cDNA Library


Date: 19:21:26 on Thu 23 Nov 117.