EST 1602069 is a singleton


Sequence

>1602069 (1 EST) Length=355 GTAAAAAAAAAAAAAAAAAGGTGCGAGANAAGCATCACTGCCTCCGCAGCGGTGGTGCTCACTTCTCTTCGTTCCCCCAA CCATTAAAGCCTTTTANTTTCCTTCTTTTTTTTTTTTTTTTGCCTCTTCTTCTCATGGCACGGCCCTCTCAGTCCTCTGG CAGCGTCGCTAACGCGTGTCCGCCCGGTGTGCATTGGCCGTGGCGGTGCCGACGAGAAGAGGGAGAAAAAAAAAAAAGAA AGAAAGCTTGAAATGTATTACCATCTAAAATAGAAAAAAAAAAAAAAAAGCTGCNGCCCCATCANGAAATAAAAATAAAA TAAAAAAAAGGGTGGGGTGGGTAGGGGCAGTCAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1602069: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16020692981556AA875726TENU0197T.cruzi epimastigote normalized cDNA Library


Date: 6:47:12 on Sat 25 Nov 117.