EST 1602071 is a singleton


Sequence

>1602071 (1 EST) Length=276 TGAGGCAATTTAAAAAAAAATCAACTTGAGGAACAAAGCATGGCACAGACGGTGATGACACGACAGCAATCACCAATCCG CTTACTTCTTCTTCGTCTGCATCTTGCCCTTCGCCTTGCCGCGGATCTTCTTGTTGCGATTGCGGCGCTCCTTCACAGAC TTGCGGGCCGGCAGCTTCTTCTTGCCCATGCCGAGACGGGCCTTGCGGTAGTTGGGCTCAATGCGCTTCAGGGCGGCGAG GTCGTCGTAGATGAGGCCGAAGCCGNTCGTCTTGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1602071: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16020712981558AA875728TENU0199T.cruzi epimastigote normalized cDNA Library


Date: 17:53:18 on Fri 17 Nov 117.