EST 1602072 is a singleton


Sequence

>1602072 (1 EST) Length=197 TGACTTCTTCAGAAGTAATCATCCGTCCACGACTCAAATTATTACAACTGGGCGCCGCATANNGGTTGGCGAAGGGAGTG CGGGTGGGCGACAGAACCAGGACCGACTGAACGGAGGCCACGNTNGCCAGCCCACCCCCATCGCAGACACAAAAAAATCA CGAACACAACTGCAAGGCAGAGACAAAGCACTCGTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1602072: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16020722981559AA875729TENU0200T.cruzi epimastigote normalized cDNA Library


Date: 19:40:23 on Mon 20 Nov 117.