EST 1602652 is a singleton


Sequence

>1602652 (1 EST) Length=411 TGCTGATACTGATGTAATTCATCAAACTACCGCCACTCAACCCAGCACATGACAACGATGAACCAGGGTACAAGGTTGCA GAATTGGAGCGTGGCACAACATTCTTGCAATTCATTAGGTTTGTATCAAATGCGGCCTCAAGTCTACCACCCTGTCCCCA TAGCGAAGAAAAAACAAATAAACGACTATTCTGAGCAATAAACACTACATGGTGACGTGGGTGTTCAGGCGATTGTGAAT CTACCATGTACGCCACGCTGTCAATAGGCTGGGTGCTGTATGGTTGTGGAAATTGGTACAATTTACGGGCTTCAAAGATG CCGTGGGTCTCCAAACGGCACGCAAGAAGGACCCCACCACTGCTGGAGCCAAGAATAATCTCACCTGTTGTCGTATCACT CTTGTTATTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1602652: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16026522982411AA875811TENU0205T.cruzi epimastigote normalized cDNA Library


Date: 6:14:27 on Sun 19 Nov 117.