EST 1602657 is a singleton


Sequence

>1602657 (1 EST) Length=482 TAAGGTTTTTTGGTTTTTGTTTTTGCGCGTACTCTCCATTCATCTCTCTCATCCCTCCCTATTTCTCTGATTCCCTCCCC TACTCACCATGCATACATATATATGCAACACTAGAATCCTTACAAAAATACCAATAAAAAGTAAAAAAAAAAAAAAAAAG AGGGAGTGAAAAAAAACTATGCGAGCCATGAACGATGCTATTGTAATGTTCACTGCTACTATGCATCCGTCTCAACACCG GCGGCGTCCAGCTTCTCCTTAATGTCGTTCATAAATGGCATAATACGTTCGCGTTGGATGCGGAGGTTCGCAACCGCCTC CTCGCCCTCCATGACAGTCCCGTCATCCTCCCAGAGGTCCGTGAAATCCTCAACGTATTGGTTCTTCGTGCTAAGGCCTT GAAACACAGCACGGTTGATAACAAACGCCTCAAGCATAATGAAGCAAAGAGTCGCCTTCAGCAGACCTTTCATCGTCTCA GC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1602657: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16026572982416AA875816TENU0210T.cruzi epimastigote normalized cDNA Library


Date: 4:25:12 on Thu 23 Nov 117.