EST 1602659 is a singleton


Sequence

>1602659 (1 EST) Length=393 ACTGCTCTCCAGACGCCGCAGCTTAAAGCAGCGGAACGGCGAGTGCGTTGCCACCGCGTNGTCGTCAGCCCACGATGGGC TGGGCGGCGGCGACAACAAGTCCAACTCAGCGCCANGCACTCGGGTGCTTGGCGGCGTTGCTGCACGCCNGAGCAGTACG CGCCGACCGCCCTCACGGCGTCCGTGGAGCTGCCACGCANACTGTGGCTGCCGCGCCGCTCGTGACTGGCAGCGGGTAGC GTCGCACGGCGGTGCAGAATTCCGAGAAGCGCCCTGGCGCACGTACGCTCCATGTGGCGAGCCAGCAGCTCGTTGTGCGT TACGCAGTGGTAGGGCATTGCACACGCAGCTCCACCCCTAACAAACTCCTACCCTCCCGCCTTCCAGCAACCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1602659: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16026592982418AA875818TENU0212T.cruzi epimastigote normalized cDNA Library


Date: 11:1:38 on Tue 21 Nov 117.