EST 1606164 is a singleton


Sequence

>1606164 (1 EST) Length=346 TATAGAGAAAAAAGGGAGAGAGCACACTTGAATCCAGAAAAAAACAACAACAACAAACAACCAAAAGAGCGACTTGGGGA AATTAATTTCGTTTTACCTCATTTCTTCTAAGATTTTATCGCATATACCAATAATAATAATAAAAAAAAAGCATAACGGT AAATAATAAAAGATCATGGGACCATGTGTTTTGTGTAAATGTACACATGCATGTAAAATCATATGGACCTCACCTTCTAC TACGGCAAGCCTCTTTTTTATGATAATGGTAATTGCTTTTTTGTTCTTGACGTTTTTTTTTCTTTTTTTTTGCCGTCCTT TTCGTCATTATTCATGACTGCTACTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1606164: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16061642988288AA879323TENU0223T.cruzi epimastigote normalized cDNA Library


Date: 23:13:49 on Fri 17 Nov 117.