EST 1606176 is a singleton


Sequence

>1606176 (1 EST) Length=392 TCTACGTTTCTTCATGCGTATTTTCATTCACCTTCCATCGACAGCCTTAAGGTGAATGCAACGGTGTGGTCCTTCTTCCT CGTACTCNGCCGCATGAACACACATGCCCTTAAAACTGCTCAACTGAGAGAGAATAACACAACCTGAGAGCGGTGCATGC ATGGGCACTNTTGCCTGCAAATGATGCGGGGGCACCTGCAAAGGCGCCACGGCATGACTCAGCGCACCACGAAAAACCTC TCGCACCCCCTTCACAGCGGACGCGCCGCCAAAAAGCACCCACTCGTTTAAGAAGGGAAAATCCATTAAACTCTTCTGAT ACGCATAGTGCACGGCAACAGGAGCACTAATGTGTGGTTGGTGAAAGAGCAACGCCTCGCCGGCCTCCCGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1606176: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16061762988300AA879335TENU0235T.cruzi epimastigote normalized cDNA Library


Date: 8:24:46 on Fri 24 Nov 117.