EST 1606179 is a singleton


Sequence

>1606179 (1 EST) Length=220 TGGAGAGCNANANACACAGAGGAGTTTCTCATGATGATGGTNNCNTCCAAGACGCTCTATGCGAAGATGGACCGCGTGGA TGGCCTGGTGGTCTTTGAGGCGAAAAAGAATNCCACGGAAGTCATCAACGGCTGGAACGAGGCGGTGGAACGCAGTGTAG CGCTGCTGGACAAGGCNTCACACCTCATTGTGAAGGAGAGGATGCTGCACAATATATCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1606179: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16061792988303AA879338TENU0238T.cruzi epimastigote normalized cDNA Library


Date: 2:48:31 on Mon 20 Nov 117.