EST 1606314 is a singleton


Sequence

>1606314 (1 EST) Length=306 TAATGCGCTCTCCATATGTCGGATNGCCCTAGTGCTGTTCGGTGGCAGGGAACGCTCCTCATAGAGCGATTTTTTCTGTG GACCGACGCGCATCGAGAGANTATTCTCGTGGGTTTCAATGACCTCCTCCTCCTTCCCGTCGCCCTCCCCTGACAATGCT AATTCGTCGCCCACCTCCAACGCTGTTCGCCACACACGCCGAAACGTGAAGTTATGAACGAGCATGCGTACACTCGTGTG AACGACATCGGGGCTGAGGGTGACGTATGAAGAAGCCAGAGAGTACCCCATGGCCTCCGTGTGTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1606314: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16063142988492AA879382TENU0248T.cruzi epimastigote normalized cDNA Library


Date: 6:7:4 on Wed 22 Nov 117.