EST 1606318 is a singleton


Sequence

>1606318 (1 EST) Length=360 GGCTGGAGAAAAGCGAGGAATCTCATGCGTGCGTGCGGTAATGCACATATTCCATAAACCACTGTGCCTTTGGGCTGCCG CAGAGGGACAACAGTGCGGGTCTTCCATGAGAGCCTTGCGTTGTTTTCCAACGCTGTATTTTCGCTTCCGAAGTTGAGGG CAATGTGCCAATTCTTTTGCCACAGAAACCTTCCTTCGCTCAGCCTCATACTGCATCCAACTGTGTCCCACTTCGTCACG AAGAAGTGTTCGAGGACGCGCGGAATAAACGTGAAAGCAACGAAGGCATCGAAAAAGTGTTTTTTCACCACTCTGCACAA TTCGGTTCCTAGTGATGCTTTGCTGGAGAAGAATGCTCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1606318: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16063182988496AA879386TENU0252T.cruzi epimastigote normalized cDNA Library


Date: 10:55:17 on Tue 21 Nov 117.