EST 1606325 is a singleton


Sequence

>1606325 (1 EST) Length=466 GGTTTCATGATGAAACCACAAAAACCGAAATGATTCATCCACAACTTCCTTTGGGTGACGGAAAAACGTTACACGGTTCT GCGCTAACGGCTCCAGTTGCCACACAGAAGCCTCCCCAACATAGTAGCGGGATGAGAATGCACCACCGGACCCCCACTGA AAACCCATCGTGAAGTGCTCCACCAAAACAGCGATATCGATAGCAGAACGTTCAAAGGTTTTGAAAGAGTCCCCCTCCTC CGCCTCTACGGAGCGATANGCCGAGGTGGGTCTCGGAGGCGAAGGCAAATGTACCGAATNTCAATAGTCCACTCCGTCGA CTCCTCACCGGTACCGTACGCCAAAATGAATGGGTCAACAGCCACTTTCTTGGGCGCAAAACGGCCTTTCCACGGCATCT CCAGGTAGTTTACAAAAAACCAGTCCAATACAAGAGAAAATTGAGGTGTGCTTCCCTGGAAAATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1606325: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16063252988503AA879393TENU0259T.cruzi epimastigote normalized cDNA Library


Date: 8:55:28 on Tue 21 Nov 117.