EST 1606326 is a singleton


Sequence

>1606326 (1 EST) Length=251 TCACGTAAAGCAGGTGCTTATAATAATATTATTTGCATTTTTTTTTCCTCCCCTCTTTCTTTTTTTTTCTTCGGTGGTGG ACGTATATATATATATATCTATTGTGTGCGATTGTTTTTGAGTGCTGCCAGGTGGAGGGTGTGCTGAGAGACTGCCCGGC GGTGCGAAGGGAAGTCCTGTGCGTGCTTCTCTGTGAGGGGCGGGGAGTGTAGTGGGGGCACGTGAGTGGATGGACGGTCT TCGCACACACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1606326: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16063262988504AA879394TENU0260T.cruzi epimastigote normalized cDNA Library


Date: 4:33:1 on Sat 25 Nov 117.