EST 1609459 is a singleton


Sequence

>1609459 (1 EST) Length=235 TCAAAAAGGGCAGAAGAAACAAAAAACAGACGGAAAATAAAAATAAAAATAAAAATACAAAAAATGGAATTTCTCTTCTA TTCTTGATGCCTCCAAATAATAACAATAACAATAAATACAAAAAAAGACAATGACCAGGAAGAGGGGGAGGAATAAAACT GAGAGTACAAAATGCAGCCAAAGCCACAGCAGGGCAATAAACGTACACACNTAAAATGAGGNTAAAACAAATGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1609459: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16094592991608AA882497TENU0272T.cruzi epimastigote normalized cDNA Library


Date: 12:0:22 on Fri 24 Nov 117.