EST 1609464 is a singleton


Sequence

>1609464 (1 EST) Length=295 TAAGCAAGGGCATATAAGTACGGAAACACGCAGAAAAAAACATATACGTATACGCCTACTCTCGGATTCATAAACTCGAC GGCCTCCACCTTTTTCTTCCCCCTAACCCCTTTTCACAAAGAGTCGCATACTTCTTTTCGTTTATTCTCCGTGCCATTGG CTGCGTGCCTCGGTGTAATGATGAGAAAAGGCAGTGCGTAGGGCACAGCAGGCCACTGCAGCCATGAGGGGNGAAAAACA GCAACCAGTAGGGGGGGTGGGAAAGGAGCCTGAGTGNTTTAAAAAAACAAGGGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1609464: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16094642991613AA882502TENU0277T.cruzi epimastigote normalized cDNA Library


Date: 9:22:55 on Sun 19 Nov 117.