EST 1609468 is a singleton


Sequence

>1609468 (1 EST) Length=403 TAGAATGGACACAACACACACACACACACAAATACAGAAGACGTCAAGAAACGTTTCAGTGAAAACGGAGAGGTGGTAAC TTTGTTTGTTGTCGTGCAAAACTAGTCGACTCCAACAAAACGTCGTTCACTAACGCTTTGCGGTAATGCGCCCACTTTCG GTGCCTATTGTATTGCCTTTCAATGTCCTCGCATGAGGGGTATCCTTTAGCAAACTCCTTCAGCTGTGCGTACTCCCGCT CATCANATATATTTCGGCAGTGGTCATGTGTTAACATGTAGAGAACACAAGTAGACTTCGTGTACACCGTGGCTTGCCGC TGTCGCGATGCTGGAGGAAATGCGGTGTCAGCCTGCTTTGGCGTGGAGATGCCGGTCCGCATACTGTGGTCATCCGCAAG AAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1609468: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16094682991617AA882506TENU0281T.cruzi epimastigote normalized cDNA Library


Date: 4:29:31 on Fri 24 Nov 117.