EST 1609470 is a singleton


Sequence

>1609470 (1 EST) Length=384 TGGCAATCGGCGGTGGCATCTGTAATCTCTCTATGTATATTTATACACGCTTGTATGTATCTATGTAAAGGATGTGTAAA TTAATTAAATGAATTCCTCAGCATCCCATATACACACCGACGCAAGATACATACATGAATTCCCTGCATCTGTGTGGCGG CATTAAAATATGTCTTCGATTCTCTTTGTAACGACACGGCGGCCCCCATAGGAAAGAAGCAAACAACAACAACTACAACA AAAATAAACCAGACGCATCAATCTACAACTTGGAGTTTGCNTTAAAAATCATCATACAATAGGCGGCTCACATCAGGAGC AAGGGCGAAGGTGGAATCATCCACCATTTCACAAACACCATTGCTACGGAGGAGAAACTTTCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1609470: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16094702991619AA882508TENU0283T.cruzi epimastigote normalized cDNA Library


Date: 21:40:19 on Fri 17 Nov 117.