EST 1609472 is a singleton


Sequence

>1609472 (1 EST) Length=221 TAAAAACACATATATATTATTTTTATTTTTGTTCTTGAGAAAGAAGGGAGAAATGGGAAGGTAATGATGATTATGTTCAC TTTTCACGACCTCATTTTCTGCCTGCCAACACCGAGCGCATACGAGCTTTTGTGCTCCTGCGAGGAACGGAGCCGCAAAG TCGTCCTCATTCATTAAAAGTGGGCATCGATTAACCCCTCACGTGTTATACGAAACAGCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1609472: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16094722991621AA882510TENU0285T.cruzi epimastigote normalized cDNA Library


Date: 20:52:33 on Sun 19 Nov 117.