EST 1609479 is a singleton


Sequence

>1609479 (1 EST) Length=258 CCTAANCTACTATCTTATTCTACTTTGCTTTTCTNCCTTCTTTTTTCTTCTTCTTTGGCTTTTTGATGGCGCGGGCCTCG TCCCACACGAGGGGTCCTCTCAAGTTGGCTGCATTCAACGTTCCGCCTCGGACCAGGCGACGAGACAGACACCGCGCTCG TACCACGCCCGCATCGGCGAATGGACGGGGTCCACTGTGAGTTCCACCACCTCANGCATCGAATCTCGTCGAGGGTTCAC GTAAAACGGTGTCGCGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1609479: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16094792991628AA882517TENU0292T.cruzi epimastigote normalized cDNA Library


Date: 23:4:55 on Wed 22 Nov 117.