EST 1609483 is a singleton


Sequence

>1609483 (1 EST) Length=294 CACGAGGGTGTCCGTCTCTGCCGAANGCATGTGAGGCAAACAGTGTTTAAATAGGTAGGAGTCATCCTCCGGTTATTAGC GTTTGGATGAATGANAAATCTTTGGCGAAATGTGTGTCGGTGTCNATGTGTGTGCTAATGAATGANAGTGTANAACTCAG GGATGGGGGAGGGGGAGGTGGGCAACAACGTGAACTGTGGCGTGAGTAAACTTTGGGTCGTTGTCTGCTTCTTTCTTTCT TTCTNCTTTTTTTTTTTTTTTTNNNCCNGTGTGTGTGTGTGTGTTTNGTNCTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1609483: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16094832991632AA882521TENS0091T. cruzi epimastigote normalized cDNA Library


Date: 6:51:40 on Sat 25 Nov 117.