EST 1609498 is a singleton


Sequence

>1609498 (1 EST) Length=273 CNAGGCCNGGCCCCAGCAACAAAACCGACGGCAGTGGTGAGACCACNCTGCGANTGTANAAACCGCGGTTCTTCATACTN GCGTGGGCGGAGGCACCATAAAAAAANANATACTCATGTNCAAGACACTACGCCTCTTACGGCCGACACCANTAGGGANC CCGTGTCTGGGCCACCTGCTGCAAATTCCCTCTCTCGTTGCANGTGCAAGGAAGTGCAAAAGGCTTCTTCTCCAGCTCCG CCATTACGTGGTGGTCAATACNAGTGTCGTTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1609498: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16094982991647AA882536TENS0106T. cruzi epimastigote normalized cDNA Library


Date: 9:3:11 on Tue 21 Nov 117.